DETAILED VIEW
VDRC ID 44155
Library GD Stocks (GD)
Construct ID 10456
CG Number (r6.01) CG3210
FlyBase gene number FBgn0005566
FBgn0005579
FBgn0026479
FBgn0031438
FBgn0042649
Synonyms Dnm1/Drp1
Drp
drp1
drp-1
Drp1
Drp-1
DRP1
dynamin-2
dynamin-related protein
dynamin related protein-1
dynamin-related protein 1
Dynamin related protein 1
frat
fratboy
l(2)22Fc
l(2)22Fd
l(2)ND2
l(2)ND3
lethal(2)22Fc
lethal(2)22Fd
near dpp complementation group 2
near dpp complementation group 3
noodle
Noodle
Hairpin Length 376
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability sterile
Inserted Chromosome 3
Left Primer CGCGAATTCCCGGAGCCCATCAACCTGAA
Right Primer GCGTCTAGATGTCCTTCTGCGAGCGATTCATAAC
Template genomic
Sequence CCGGAGCCCA TCAACCTGAA GATATTCTCA ACGCACGTGG TCAACCTAAC GCTGGTGGAT CTGCCCGGCA TCACCAAGGT CCCGGTGGGC GATCAGCCGG AGGATATCGA GGCGCAGATC AAAGAATTGG TCCTCAAGTA CATTGAGAAC CCGAACTCCA TCATTTTGGC TGTGACGGCC GCCAACACGG ACATGGCCAC CAGTGAGGCA CTCAAGCTGG CCAAGGACGT GGACCCCGAT GGCCGGCGCA CTCTGGCCGT GGTCACGAAA CTGGATCTCA TGGATGCCGG CACCGATGCC ATCGACATCC TGTGCGGCCG GGTCATTCCC GTCAAGCTGG GCATCATCGG CGTTATGAAT CGCTCGCAGA AGGACA