DETAILED VIEW
VDRC ID 43183
Library GD Stocks (GD)
Construct ID 5335
CG Number (r6.01) CG9140
FlyBase gene number FBgn0031771
Synonyms
NADH dehydrogenase
NADH ubiquinone oxidoreductase 51 kDa
NADH:ubiquinone oxidoreductase 51 kDa subunit
ubiquinone
Hairpin Length 325
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCATGCGCCACGATCCACACAA
Right Primer GCGTCTAGAGGCAACCGAACACACCCACA
Template genomic
Sequence ATGCGCCACG ATCCACACAA GCTGGTGGAG GGCTGTCTGA TTGCCGGACG CGCCATGGGC GCCCAGGCTG CCTACATCTA CATTCGTGGC GAGTTCTACA ACGAGGCTTC CAACATGCAA CTGGCCATTG CCGAGGCCTA CCAGGCTGGT CTGATTGGAA AGAATGCGTG CGGAACAGGC TACGACTTCG ACGTCTTCAT GCACCGCGGC GCTGGAGCTT ACATTTGCGG CGAGGAGACC GCTCTGATCG AATCGCTGGA AGGAAAGCAG GGAAAGCCAC GCTTGAAGCC GCCATTCCCA GCTGATGTGG GTGTGTTCGG TTGCC