DETAILED VIEW
VDRC ID 40478
Library GD Stocks (GD)
Construct ID 11094
CG Number (r6.01) CG3869
FlyBase gene number FBgn0029870
FBgn0044368
Synonyms anon-WO0125274.3
dmfn
dMfn
dMFN
Drosophila mitofusin
marf
Marf
MARF
Marf-1
mfn
Mfn
mfn2
mitochondrial assembly regulatory factor
Mitochondrial assembly regulatory factor
mitofusin
Mitofusin
Hairpin Length 312
ON Targets 1
OFF Targets 1
s19 0.99
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCGAGGGCTTTCAGATACGCTACTTC
Right Primer GCGTCTAGATTGACACCTTCTCCTCCACCTCCTC
Template genomic
Sequence CCGAGGGCTT TCAGATACGC TACTTCGAGT TCCAGGACTT CGAGCGCAAG TTCGAGGAGT GCATCTCGCA GAGTGCTGTG AAAACAAAGT TCCAGCAGCA CAGTTCGCGC GGCAAGAGTG TTTCGGGTGA CATGAAATCA ATGTTGGACA ACATTTACGA GCGGATCACC ATATTCCGCA ATCTGAAGCA GGACCAGAAG AACCTGCTCA CCGAACGCAT CCAGGGCACA GAGACGCAGA TGATGCAGGT TACGCGGGAA ATGAAGATGA AGATCCACAA CATGGTCGAG GAGGTGGAGG AGAAGGTGTC AA