DETAILED VIEW
VDRC ID 40399
Library GD Stocks (GD)
Construct ID 12050
CG Number (r6.01) CG6831
FlyBase gene number FBgn0020254
FBgn0035910
FBgn0260442
Synonyms CT21159
rhea
Rhea
talin
Talin
tendrils
Tln
Hairpin Length 387
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCGGTCAAACGCAGGAAGAGGAG
Right Primer GCGTCTAGATGCGACTGCTTGGCATTGTTG
Template genomic
Sequence CGGTCAAACG CAGGAAGAGG AGGTGCGCTC ACATATGATC GAGTCCCTGC GACATGTCTC CACTCAATCA TGCTCTCTCC TCTCGACGGC CAAGTCGATT GCCGCCGATC CAGGTCAACC TAATGCGAAG AACCTGCTGC ATGCCGCTGC CCGAGGTGTG ACCGAAAGTA TCAATCAGTT GGTTGATGCC AGCATCCAAT CCGCTCCCGG ACAAAAGGAG TGCGACAACG CTATGCGCAA CATTGAAGCC TTGCGTCTCA TGTTGGATTA TCCCCATGAA CCTATCAACG AGTTGGGATA CTTCGATTGC GTAGAACAAG CCACTGGAAA GTCAAGAAAC CTTGGCTACG CTATCTCCGA GATGATCAAC AATGCCAAGC AGTCGCA