DETAILED VIEW
VDRC ID 40138
Library GD Stocks (GD)
Construct ID 9531
CG Number (r6.01) CG18214
FlyBase gene number FBgn0015758
FBgn0024277
FBgn0028051
FBgn0028162
FBgn0035180
FBgn0035182
FBgn0046252
Synonyms 0368/10
0959/14
1372/03
1386/06
BEST:LD36950
CG9208
dTrio
DTrio
l(3)036810
l(3)6D104
l(3)S036810
l(3)S095914
l(3)S137203
l(3)S[1372/3]
l(3)S138606
l(3)S[1386/06]
l(3)trio
M89
trio
Trio
TRIO
UNC-73/Trio
Hairpin Length 325
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 5
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGCGAATCACTAAATACGAGCTACTCATCAAGG
Right Primer GCGTCTAGAGGGACTGGCATACTGGTTCTTGGTCT
Template genomic
Sequence GCGAATCACT AAATACGAGC TACTCATCAA GGAGATCATC AAGGCCACCG AGGGAGCCGG GCTTTACAAG GAGGTGCCCA TGCTGCAGGA GGCCTACCAA CAGATGAAGG TCGTCGTCAA GACGGTCAAC GATATGATGG TGGTGCTGCG CAGCTTGCAG GACTTCGATG GGGAGATAAC CGCCCAAGGC AGCCTGTTGA TGCAGGGACC CATGAACTGC GTGGTGGATG CGGCACAGAA GCACCGCGAG CTTCAGGTGT TCCTCTTCCA GCAGATCATC ATCTTTGCGG ATATTGAGAA GACCAAGAAC CAGTATGCCA GTCCC