DETAILED VIEW
VDRC ID 35023
Library GD Stocks (GD)
Construct ID 11719
CG Number (r6.01) CG5648
FlyBase gene number FBgn0032492
FlyBase recombinant construct FBtp0025151
FlyBase Reference Reports FBrf0214518
FBrf0202579
FBrf0200327
Synonyms 5648
alpha6T
Alpha6T
prosalpha6T
Prosalpha6T
Proteasome alpha6 subunit, Testis-specific
Proteasome alpha6T subunit
Hairpin Length 326
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCAGGCGGTGAAACAGGGAGCA
Right Primer GCGTCTAGAAGCCACCAGCAAGCCCACAC
Template genomic
Sequence AGGCGGTGAA ACAGGGAGCA GCCACCGTGG GACTCAAGGG CACCGACTAT GCCGTGCTGG CCGCCCTGTG CCGCACCTCA AAGGACACGA ACACGCTCCA GCGGAAGATC ATGCCGGTGG ATGACCACGT GGGTATGTCT ATCGCAGGAC TAACGGCAGA TGCCCGCGTG GTGTGCCAGT ACATGAGGAC GGAGTGCATG GCATATCGGC ACTCCTATAA CGCAGAATTT CCGGTTCGCC GTTTGGTTTC CAATCTGGGT AACAAGCTGC AGACCACCAC CCAGCGCTAT GATCGTCGTC CCTACGGTGT GGGCTTGCTG GTGGCT