DETAILED VIEW
VDRC ID 330404
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5733
FlyBase gene number FBgn0034310
Synonyms Nucleoporin 75
Nucleoporin 75kD
nup75
Nup75
Nup 75
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGGGTGGAGAACGTTGACGAA
21bp Sequence
(antisense)
TTCGTCAACGTTCTCCACCCG
Hairpin Length 71
Sequence ctagcagtCGGGTGGAGAACGTTGACGAAtagttatattcaagcataTTCGTCAACGTTCTCCACCCGgcg
Category shRNA Stocks