DETAILED VIEW
VDRC ID 330342
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG6708
FlyBase gene number FBgn0020626
Synonyms osbp
Osbp
OSBP-Dm
oxysterol binding protein
oxysterol-binding protein
Oxysterol binding protein
Oxysterol Binding Protein
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGGATTCGGACAAGTTTTATA
21bp Sequence
(antisense)
TATAAAACTTGTCCGAATCCG
Hairpin Length 71
Sequence ctagcagtCGGATTCGGACAAGTTTTATAtagttatattcaagcataTATAAAACTTGTCCGAATCCGgcg
Category shRNA Stocks