DETAILED VIEW
VDRC ID 330331
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4859
FlyBase gene number FBgn0022198
FBgn0035049
Synonyms dm1-MMP
Dm1-MMP
dmmp1
dMMP1
l(2)k04809
matrix metalloprotease
matrix metalloprotease 1
Matrix metalloprotease 1
matrix metalloproteinase 1
matrix metalloproteinase-1
Matrix metalloproteinase1
Matrix metalloproteinase 1
Matrix metalloproteinase-1
Matrix Metalloproteinase 1
metalloproteinase
mmp1
Mmp1
Mmp 1
MMp1
MMP1
MMP-1
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGATGCGGCGTTCACCTACAA
21bp Sequence
(antisense)
TTGTAGGTGAACGCCGCATCG
Hairpin Length 71
Sequence ctagcagtCGATGCGGCGTTCACCTACAAtagttatattcaagcataTTGTAGGTGAACGCCGCATCGgcg
Category shRNA Stocks