DETAILED VIEW
VDRC ID 330299
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG15792
FlyBase gene number FBgn0002742
FBgn0004415
FBgn0005634
FBgn0010524
FBgn0026658
FBgn0044594
FBgn0265434
Synonyms anon-WO0140519.37
cytoplasmic myosin
cytoplasmic myosin heavy chain
cytoplasmic myosin II
cytoplasmic myosin-II
DmnmII
Dm nmII
DROMHC
Dronm-MII
E(br)
Enhancer of broad
l(2)02957
l(2)17F1
lethal (2) 17F1
MHC
Mhc-c
Mhc-c[1]
Myo
Myo2
myoII
myo II
MyoII
Myo II
Myo-II
Myo-II HC
Myo-II heavy chain
myosin
Myosin
myosin 2
Myosin 2
Myosin-2
Myosin HC
myosin heavy chain
Myosin heavy chain
Myosin Heavy Chain
myosin-heavy-chain-cytoplasmic
Myosin heavy chain-cytoplasmic
myosin II
Myosin II
Myosin-II
myosin II heavy chain
Myosin II heavy chain
myosins II
NMM
nmMHC
NMMII
nmy-2
non muscle myosin
non-muscle myosin
non-muscle myosin heavy-chain
nonmuscle myosin heavy chain
non-muscle myosin II
nonmuscle myosin II
non-muscle Myosin II
Nonmuscle myosin-II
non-muscle myosin II heavy chain
nonmuscle myosin-II heavy chain
nonmuscle Myosin II heavychain
zip
Zip
ZIP
zip/MyoII
zipper
Zipper
Zipper heavy chain
zpr
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
AGGAGTCGCGCTCTAGACTAA
21bp Sequence
(antisense)
TTAGTCTAGAGCGCGACTCCT
Hairpin Length 71
Sequence ctagcagtAGGAGTCGCGCTCTAGACTAAtagttatattcaagcataTTAGTCTAGAGCGCGACTCCTgcg
Category shRNA Stocks