DETAILED VIEW
VDRC ID 330283
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10823
FlyBase gene number FBgn0038880
FBgn0046533
FBgn0046534
Synonyms anon-WO0170980.43
anon-WO0170980.44
DrmSIFR
SIFamide receptor
SIFamide-receptor
SIFaR
SIFa-R
SIFR
SIF-R
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGGACTCAATTGTGTCCTACA
21bp Sequence
(antisense)
TGTAGGACACAATTGAGTCCT
Hairpin Length 71
Sequence ctagcagtAGGACTCAATTGTGTCCTACAtagttatattcaagcataTGTAGGACACAATTGAGTCCTgcg
Category shRNA Stocks