DETAILED VIEW
VDRC ID 330277
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG10342
FlyBase gene number FBgn0027109
Synonyms DmNPF
Dm-NPF
dnpf
dNPF
Drm-NPF
long neuropeptide F
neuropeptide F
neuropeptide-F
Neuropeptide F
Neuropeptide F 1
npf
Npf
NPF
NPF89D3
NPF-A1
NPF-A2
NP-PP
NPY-like neuropeptide F
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
GAGATGGACAACATAAATCTA
21bp Sequence
(antisense)
TAGATTTATGTTGTCCATCTC
Hairpin Length 71
Sequence ctagcagtGAGATGGACAACATAAATCTAtagttatattcaagcataTAGATTTATGTTGTCCATCTCgcg
Category shRNA Stocks