DETAILED VIEW
VDRC ID 330233
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4395
FlyBase gene number FBgn0030437
FBgn0046551
FBgn0046625
Synonyms anon-WO0170980.1
anon-WO0170980.2
hec
hector
Hector
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
GCACTACTTTATGTTGGTCAA
21bp Sequence
(antisense)
TTGACCAACATAAAGTAGTGC
Hairpin Length 71
Sequence ctagcagtGCACTACTTTATGTTGGTCAAtagttatattcaagcataTTGACCAACATAAAGTAGTGCgcg
Category shRNA stocks