Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 330164
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG9206
FlyBase gene number FBgn0001108
Synonyms dynactin
Dynactin
Dynactin P150
DYNA_DROME
FCP-D
Gl
Glu
glued
Glued
p150
P150
p150glued
p150/glued
p150[glued]
p150-Glued
p150/Glued
p150[Glued]
P150[Glued]
t1
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
GCGGACCGACACAGAACTTTA
21bp Sequence
(antisense)
TAAAGTTCTGTGTCGGTCCGC
Hairpin Length 71
Sequence ctagcagtGCGGACCGACACAGAACTTTAtagttatattcaagcataTAAAGTTCTGTGTCGGTCCGCgcg
Category shRNA Stocks