DETAILED VIEW
VDRC ID 330125
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG5490
FlyBase gene number FBgn0003717
FBgn0062707
FBgn0262473
Synonyms CT17414
dToll
dToll1
EP1051
EP(3)1051
Fs(1)Tl
Fs(3)Tl
mat(3)9
mel(3)10
mel(3)9
Protein toll precursor
T1
tl
Tl
TL
TOL
toll
Toll
toll-1
Toll1
Toll-1
toll receptor
Toll receptor
Vector pWALIUM20
Landing Site attP40
Viability lethal
Inserted Chromosome 2
21bp Sequence
(sense)
CGGATTCGAGACGAACGATTA
21bp Sequence
(antisense)
TAATCGTTCGTCTCGAATCCG
Hairpin Length 71
Sequence ctagcagtCGGATTCGAGACGAACGATTAtagttatattcaagcataTAATCGTTCGTCTCGAATCCGgcg
Category shRNA Stocks