DETAILED VIEW
VDRC ID 330108
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG4313
FlyBase gene number FBgn0025632
Synonyms
EG:22E5.10
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
AGGACCGGAGATTGCTTAAGA
21bp Sequence
(antisense)
TCTTAAGCAATCTCCGGTCCT
Hairpin Length 71
Sequence ctagcagtAGGACCGGAGATTGCTTAAGAtagttatattcaagcataTCTTAAGCAATCTCCGGTCCTgcg
Category shRNA Stocks