DETAILED VIEW
VDRC ID 330080
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG3025
FlyBase gene number FBgn0014340
Synonyms dmMOF
dMOF
males absent on first
Males absent on first
males absent on the first
males-absent-on-the-first
Males absent on the first
males-absent on the X
max
mof
Mof
MOF
MOF histone acetylase
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
CGACCGCAAGATGACACGCTA
21bp Sequence
(antisense)
TAGCGTGTCATCTTGCGGTCG
Hairpin Length 71
Sequence ctagcagtCGACCGCAAGATGACACGCTAtagttatattcaagcataTAGCGTGTCATCTTGCGGTCGgcg
Category shRNA Stocks