DETAILED VIEW
VDRC ID 330077
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG2904
FlyBase gene number FBgn0000542
FBgn0025376
Synonyms ec
Ec
echinus
EG:EG0002.3
Q1W9Q0
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
ACAGCAGACACTGAATCAGAA
21bp Sequence
(antisense)
TTCTGATTCAGTGTCTGCTGT
Hairpin Length 71
Sequence ctagcagtACAGCAGACACTGAATCAGAAtagttatattcaagcataTTCTGATTCAGTGTCTGCTGTgcg
Category shRNA Stocks