DETAILED VIEW
VDRC ID 330072
Library shRNA Stocks (shRNA)
CG Number (r6.01) CG2210
FlyBase gene number FBgn0000150
FBgn0011322
FBgn0024573
FBgn0025960
FBgn0046351
FBgn0046352
FBgn0062949
FBgn0064938
Synonyms 1084/08
abnormal wing disc
abnormal wing discs
Abnormal wings disc
anon-EST:Liang-2.27
anon-EST:Liang-2.28
anon-WO0172774.80
anon-WO0172774.82
awd
Awd
BcDNA:GM19775
BcDNA:RH27794
clone 2.27
clone 2.28
eshiA
e(shi)A
killer of prune
Killer of prune
Killer-of-prune
Kpn
K-pn
l(3)j2A4
l(3)L8700
NDKB
NDPK
NDP kinase
Nm23/awd
nucleoside diphosphate kinase
Nucleoside diphosphate kinase
Vector pWALIUM20
Landing Site attP40
Viability viable
Inserted Chromosome 2
21bp Sequence
(sense)
TCGCCCTGTGGTTCAACGAAA
21bp Sequence
(antisense)
TTTCGTTGAACCACAGGGCGA
Hairpin Length 71
Sequence ctagcagtTCGCCCTGTGGTTCAACGAAAtagttatattcaagcataTTTCGTTGAACCACAGGGCGAgcg
Category shRNA Stocks