DETAILED VIEW
VDRC ID 30670
Library GD Stocks (GD)
Construct ID 4673
CG Number (r6.01) CG3302
FlyBase gene number FBgn0013767
FlyBase recombinant construct FBtp0031923
FlyBase Reference Reports FBrf0200327
FBrf0227862
FBrf0229266
FBrf0214518
FBrf0202579
Synonyms cor
COR
Cora
corazonin
Corazonin
crz
Crz
CRZ
Dm-Crz
Drm-COR
preprocorazonin
Hairpin Length 383
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGCCCCTCTTCCTCTTCACGCTCT
Right Primer CGCTCTAGAGGAGTTCGTTGGACTGGCGATG
Template cDNA
Sequence GCCCCTCTTC CTCTTCACGC TCTCCATGTG CATGGGCCAG ACCTTCCAGT ACTCCCGCGG ATGGACCAAC GGCAAGAGGT CCTTTAACGC CGCATCTCCC CTCCTGGCCA ACGGCCATCT CCATCGGGCC AGCGAGCTGG GACTCACGGA TCTCTACGAT TTGCAGGATT GGAGCAGCGA TCGTAGGCTC GAGCGCTGTC TATCGCAGCT CCAACGTTCA CTGATTGCCA GAAACTGTGT CCCCGGTTCG GACTTCAATG CCAACCGAGT AGATCCGGAT CCCGAAAACA GCGCCCATCC CAGACTGAGC AACTCTAATG GCGAGAATGT TTTGTACTCA AGTGCCAATA TCCCCAACAG ACATCGCCAG TCCAACGAAC TCC