Note: this item is temporarily unavailable.
 
DETAILED VIEW
VDRC ID 24704
Library GD Stocks (GD)
Construct ID 11955
CG Number (r6.01) CG6546
FlyBase gene number FBgn0025716
FBgn0034216
FlyBase recombinant construct FBtp0025373
FlyBase Reference Reports FBrf0232814
FBrf0200327
FBrf0214431
FBrf0214518
FBrf0202579
Synonyms Baf53
BAF53
bap55
Bap55
BAP55
Brahma associated protein 55kD
Brahma associated protein 55 kD
brahma associated protein of 55kD
BRM-associated protein 55
Hairpin Length 310
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 2
Left Primer CGCGAATTCAGACGTTGTTAAGGAGCGCGACA
Right Primer GCGTCTAGACGCATCACACATGCCCACAC
Template genomic
Sequence AGACGTTGTT AAGGAGCGCG ACAACGGACG CTTCACGCTG CGCAAACTGC CAGAGAACCT AACTCAGTCG TGGCAAAACT ACATGTTGCA GCTCATGATG CAAGACTTTC AGATGAATGT GCTGCAGGTC CTAGAAAATC CGTTCGACGA ACGGGTTGCT GCTCAAATCC CGACGGTACA CTATGAGTTT CCTAATGGTT ATCATCAGGA CTTTGGCTCT GAGCGGTTCA AGATAGCCGA GAGTCTCTTT GACAATGCAA TGCTGGGAGC TGGCCAATTG GCGTCCACCA GTGTGGGCAT GTGTGATGCG