Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT060737
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 205286
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 260737
Nearest Genes
Gene Nr FlyBase ID Distance
CG32651 FBgn0052651 10334 bp
CG15732 FBgn0030385 18199 bp
Sequence Length 2120
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CAAACTCTGCACAAAATAATGATGTTTCCTGG
Right Primer TGCACTGAAGATGCTCCACTTGGG
Template genomic
Sequence CAAACTCTGC ACAAAATAAT GATGTTTCCT GGAAGATTTG ATTTGGCCTA AGCCAATTCC TAATCTTCTT TCGCACTCGC ACTTGATTCA ATTTCAAAAT ATTTTCCTGG CGCCAAACGG AAAAAGGCAA AATGAAAGGG GAAAGTGGTA CGGTGAATTG GGAATGGGCA GGAAAAACAG GATGATGGGA ATTCGCAGGA TGTTGGGCAC TAAAGGTGCT CAAATATTTA TGCCCCTTGT GGTGGATAAC CGAAGAAAAT ACAATGAAAC TAAATAAGAA TATTGCGATA TACAATAACA GACTCCCACA GCCCAATCCG CTGAATAAAA CATAGACACC GAAAAAAAAA CTATTATTAA GCAAAAAATT AAATATTAGT AAAATATACA TATATATATA TAATATATGT TTTTCTCTAC ATTACTCTCT AAAAGTTGAT ATAAACTTTT CCAGCCATAC AACTCCCTAG CAATTTCGAT AATAACTTAC CCTATAACGT TGGTTTCCTT AGCTGTTTTT ATTCCAGTTA TTTCACCATT TTTTTTAAAT TTAAGTGCAT TTTTTGCAGT GTAAGAAATG GTGTTGCTTC TGCATAATCA TAGGTGGGTT GGGCTGTCTA CCGGGCTTCG CAATGAATTT CTGAATTTAG GCGCTGCTCT TCTTTATGAA ATGCCTCCCC TAACGATCCG TATCTTCGCA TATGAGTAGT GCACAATTAC ACACATTTTT CCTCCTGCAT TCGCATGTGT CTGTGTAGCA TTTCCCTGCA ACTGTGTGCG AAATGGGCGG AACTGAAGTG GGCGGCATCA AATATTTATG GACGTGCCAG GGGAAGCCGC CAAGCAATCG CTTCATATTC AATATTCAGT TGTTACGCGC GGCAAGTGCA GCAAATTGCC AATTCGCCAT TCCAATAAGC CAAAACCAAA TGAGCAGCAG CCAAACAATG GCCAAGTCCC TATATATCCA TCCGGATATC CCACTCGATA TGTTTGGGCC ACGGGCCAAA AGCGTTTTGG AGACGAACAG ATTCGCGTTG AGATGGAATC GGGAATGGAG CTGGTTAGGG TTGATGGGAT GGTGGATGGT GGATGGCGCT GCCTCCGAAG CAATTATCCC GCCCAGCACA ATAAAATCCA CATATTGAGC TGGCCCACAC AAATATGTTT CCGTTTGGAG TCGTTGGACT TATGGATAGA GTGTGGGGCT AGGCTTAAGC TGGATTAAGG TAAAGATAGT ATATTTCGTA TTATTTGGGG GGCTTCAAAA ATCTGACTTA ATCTGCGTAC CAGTAAATGG GGAGTATATA ATGCATTTTA TACATAAAAA AGATAATCAT AATAAACTTT GATTAGTTAG TTAGTTAGTT AATCATATTT ATTTATTTAG TTAATCATAT TTATTTGTTT ACTACCTTTG CATATGGATT ACTTCTACTC GAGTACTTTT TTGCGGACCA CGTAAATTTG ATTTAGCCCA CTTATTTATG AGTTAACGAG AATTAACCCG TCATGTCAGC GAAAATAATG ACGTCGGCTT TATCCTATTT ACCCCCCCCC CCCCCCCCAT CACTAATGAC CCGAAAGTGC ACGAGTATCT GTATCTGCAT ATGTAAATGC AATCAAATTC GCAACGGTCA TTTGGCCAGC CAGCCAATCT AATGGGGGCG TGTCATTTAT GTATTCATAA AGCAGCCACC GACGCTGCAT CTGAATGATG TTTACCTCAT AAATAAATAA TTGTTAAGCA CAAATGTGTG TAGCTTCACT GGCAGCAGCA GACAAATTAC CAACGGTTCA AAATGTTGCC AAAAGTTCTT CGTCCCGAAA AAAAGAGAAA AAAAAACCAA ATAAAAAAGT ACAAAAATTA AAACAAAAAC GCGGTCTACG GATGTAAAAT ACTACCCACA CACTGCCAAA TCTTTTTGTA TGTATTACAG GTGTTGCAAC AGCCAAAATG TTGGCTGTAC CACAGGCAAG TTACACTAAA GTAGACACAG TACTTCAGCC CAACAGAGCA GGTGTTAAAA TGTCTTACAA AGTTTAAGAA CAGTTTTTCT CCAATTTATG ATGGCATCTT ACTTTGATAT TTAGCTCCCA AGTGGAGCAT CTTCAGTGCA