Vienna Tile Information
VT ID VT026020
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 203479
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226020
Nearest Genes
Gene Nr FlyBase ID Distance
CG34391 FBgn0085420 16060 bp
CG10633 FBgn0035604 30387 bp
Sequence Length 2367
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAGTTTGCCATCTTTATGACCCCGA
Right Primer TCATGAAAAGTTTGGCCACTAGGCA
Template genomic
Sequence AAGTTTGCCA TCTTTATGAC CCCGACCGCA CACAGACACA CATTCAAAGA TCCTGGGATG TACACACAAA CACAAACACA AACTCACACA CACAGACAAG CACACCCATC GGCTAGATTA AAGTGTAAAT ATTTAATGCG CGGGTCGCTT TGAATTATTC TAGATGTCTG TTTTGACTGA CTGACTTTCT GTGTGTGTCT TGTTTTGTCA ATATTTTTAG GTTTCGATTT TACCTTAAAG CTGGACCAAC TTAAATACCG GCTTGCCAAC CAAAGTTATT ACACATACTA ATATTTTACT TTCAACTCGC TGAAGGACTT TGAAGATAAG GGTTTTAGGA AGAATATGAA GTTTTTAAAT TTTTAAAGTT GTCCAAAATT AGTCAAATAT ATTTATTCTT TTTACTATAA GTTTTTATGG GTTAATTTTT TGCAGCATAG TTTTACAAAT ACTTTCTCTA GAAATTGCTT CAGTTGGCCA TCATGTTTTT GTAGATCCTT CGAGCCCTGT TCTGAAAAAG CTTAACATAT TCCTGATCAA TCTGGCTTGT TTGCTGCTCT GAGCTGTGTT TACTTTCAGG CTTCTGCTCT TGCTTGCTAT TAGCCAACGA GCAAGTTCCT AAAAGGCAGT CAAGCAATGT CTAACCAGCT TCGGAAAGAA TACGTCTCAA ATCGATTACA CTGCCGGGTA TGTTGAATCT AAAACTACAT TTTAAACTCC GTTAGAGCAT TAAACAGTCG GACTTCGATG CCTTGCCATT TCCAACATCT CTGGCGGTTA CTTTCGGCTT GTTGCTCCTG CTGCTGCCGC TGCCAGTAGC AAGTTTTTGC CAGTGCTTAA ACATTAACAA GTGCATCAGG CCGGCAAAGT TTTGGCCCAA AACTTTGGGC CGGCAGCATA AAAAGTCCCA GGCAACTGCC GTTATTCGGA AAATCAATTA CCGCACACAT AGCCGGGAAT CTGTGGCCAC TTCCCGCTGC CTAACTATCC TGCCGACTTT CCCTCCGAGA TCCTGGCACT ACGCATCTTG TCTGGCGCTA ATATGGCCGC AACGACAATT GACCGACATT TTATTTAATG TCCTCGTTCA TTAGGCGGCC GCAGGCTTCG CAGAGTGCTC CTTACCGCAG CCGCATTTGG TCCGCAACCG TTCACGTAAA CAAAAGCCGG GAAAAGCGGC TAGACGGTAA TACACTGGGA AAAAAAGAAC AGAACAGTTT ATTGGTGAAT GAACGAGGTG TGAGCTACCT GCTAACTACC ACACCAAGTT TACAAAGTTC TTAAAAAACG GTAAGCGCAT TAAATGTCTA TTACAATGTA TATTTGAAAA ATCTATGACA AACTTGCTAA AAAGCCATTG TTTTTCTCAG TGTAAAGGTC TAACCACAAA ATTAGAAGCT GGTCGAACTT GCTCCCTTTT ACCTCCGTGG CCACCGAAAC TATTGCTTGT AAGTCGATCA TGTGTTTGTA TCTTAATCTG ATAAATACGT GGCCGAGGTT CTCCGGTTCG TCGTTTGTTT GTACTGAGTT CCTGCAGTCG GTTATTGATG GTCGAAAAGT GGTTGTTGTT GTGTTGTTGC AACCGTTGCT GTAGTTTCTG CAGTTGTTGC TGCGGGCTTC CGCTGGCAGC CAAGTGCTGG GATTTTCCGC TGCCATGGCG AGCTGAATTT GCTGGGAAAG AGATACGAAC TGTGGTCACG AATCGAACGC TTTTGCTGGG CTTAAAGCAG CTACAAATTG AACAAACTTT GGGTCGATAA ACCCCATCGA TTTATTAAAT AGCCCCAGGG GCACTTTAAA TTGAATAGAA GTGAAAACCG TTGCAGCAAG CAATAAAAAT AATATTAATT TAATATATTT TGCGGTGGCC GTTGACATGC GGAAATGTGA CCGCAGCTCA TTTAAAAATG TAAGTGGAAA AAAAGGGAAA ACCATTTCTG TGTAAACAGA GGCATTCTTC TTTTTTTCGT CCACATTTAA ATCAGAATTT TTTCCGCTTA ACCATTAATG GTTTCAACAA TTCGCAGCTG ATCTGGTTGG CCATTAAATC AGACACATTA TCTGCAAACC AACAAATTTA TTCTGCCCTA AAGGGGATAT GCGAGTATGT AGACTTGACC TACAAACGAG TTTTTCATTT AATTAAGTTT CATGCACGCA GAAGTCTGTA TGTGTGTGGA AAATTTGCAA GCTTTTCCGC AGTGATTTAT GAGTTGCAAT CCTTCTCAGA TGTCCTGCGG TGTGTGGAGC GACAAAGTTT GCTCAAAGAA TATTTGAAGA CAGTTTTTGC CCTTTCGAGT GTCAGTTACA TTATTCATCT AAGCAAAAGT AAACTTAATA TTTGCCTAGT GGCCAAACTT TTCATGA