DETAILED VIEW
VDRC ID 16840
Library GD Stocks (GD)
Construct ID 5827
CG Number (r6.01) CG7997
FlyBase gene number FBgn0034117
Synonyms
CT24026
Hairpin Length 301
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCAACCTTTGCGGATTGGGATGTG
Right Primer GCGTCTAGAGCCATGCGGCTGAATCCTGT
Template genomic
Sequence AACCTTTGCG GATTGGGATG TGGACTACGT GAAGCTGGAC GGCTGTTATG CCAATATCAG CGACATGGCC TCGGGCTATC CGGAGTTCGG ACGCCTGCTC AATGAAACTG GTCGACCGAT GGTATACTCC TGCAGTTGGC CCGCGTATCA GGAGGATGCA GGAGAAATGC CCGATTATGA GTCACTCAAG CAGCACTGTA ATCTGTGGCG CAACTGGGAC GACATCGAAG ACTCGCTCGA GTCCCTTATG CAGATCATTG ACTACTTTGC CAAGAATCAG GACAGGATTC AGCCGCATGG C