DETAILED VIEW
VDRC ID 13959
Library GD Stocks (GD)
Construct ID 5803
CG Number (r6.01) CG6692
FlyBase gene number FBgn0013770
FBgn0019814
FlyBase recombinant construct FBtp0032886
FlyBase Reference Reports FBrf0202579
FBrf0214518
FBrf0216574
FBrf0200327
Synonyms cathepsin L
Cathepsin L
Cath L
CATL_DROME
cp1
Cp1
CP1
CT20780
CTSL
CysP-1
cysteine proteinase 1
cysteine proteinase-1
Cysteine proteinase-1
Dcp1
Dcp-1
DCP1
Drosophila Cysteine proteinase-1
fs(2)50Ca
L-like cysteine protease
Hairpin Length 345
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCCCACCAAGTACGGCAACAATGGA
Right Primer GCGTCTAGACGAAGCCAACGACCAGCACA
Template genomic
Sequence CCACCAAGTA CGGCAACAAT GGATGCAACG GCGGTCTCAT GGACAATGCC TTCCGCTATA TTAAGGATAA TGGAGGCATC GATACCGAGA AGTCCTATCC CTACGAGGCC ATCGATGACT CGTGCCACTT TAACAAGGGC ACAGTCGGAG CCACCGATCG TGGATTCACC GATATTCCCC AGGGTGATGA GAAGAAGATG GCCGAGGCTG TGGCCACCGT TGGTCCCGTT TCCGTCGCCA TCGATGCCTC CCACGAGTCG TTCCAGTTCT ACTCGGAGGG CGTCTACAAC GAGCCGCAGT GTGATGCCCA GAATCTGGAT CACGGTGTGC TGGTCGTTGG CTTCG