DETAILED VIEW
VDRC ID 13351
Library GD Stocks (GD)
Construct ID 5007
CG Number (r6.01) CG4889
FlyBase gene number FBgn0001109
FBgn0003467
FBgn0003469
FBgn0004009
FBgn0011783
FlyBase recombinant construct FBtp0032215
FlyBase Reference Reports FBrf0210104
FBrf0222831
FBrf0222251
FBrf0225573
FBrf0224178
FBrf0200327
FBrf0214518
FBrf0202579
FBrf0230512
FBrf0216411
Synonyms Br
Bristled
Complementation group I
Dint-1
Dm-1
Dm Wg
DWint-1
dWnt
DWnt-1
fg
flag
Gla
Glazed
I
int-1
l(2)02657
l(2)rO727
l(2)wg
Sp
spade
spd
Sternopleural
wg
Wg
WG
wgl
wingless
Wingless
wnt
Wnt
WNT
wnt1
Wnt1
Wnt-1
Wnt/Wg
Hairpin Length 329
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGGATCCAGCGGAGATGCGACAGGAGTG
Right Primer CGCTCTAGAGTCTTGCTGATCGGGTGGCTGT
Template genomic
Sequence AGCGGAGATG CGACAGGAGT GCAAATGCCA TGGCATGTCC GGATCGTGTA CAGTGAAGAC CTGCTGGATG CGACTGGCCA ACTTCCGTGT GATTGGCGAC AATCTGAAGG CCCGCTTCGA TGGAGCCACC CGCGTGCAAG TGACCAACAG TCTCCGGGCC ACCAACGCTC TGGCCCCAGT TAGTCCGAAT GCAGCCGGCT CGAATTCCGT GGGCTCCAAC GGCCTGATTA TTCCGCAGTC TGGTCTGGTC TACGGCGAGG AGGAGGAGCG TATGCTGAAC GACCATATGC CGGACATCCT GCTAGAGAAC AGCCACCCGA TCAGCAAGA